Service Notice: Due to the blizzard currently hammering the US Northeast, the Broad is shut down and the GATK forum will be mostly unattended while we hunker down and sip hot cocoa with marshmallows. Assuming the power stays on and we're able to dig ourselves out of the snow when it's all over, normal service should resume Wednesday or Thursday.

Insertion interpretation

brdidobrdido Posts: 27Member

Hello again,

we are having trouble trying to understand a insertion called by HaplotypeCaller (HC).

First we can't see any read confirming the insertion in IGV.

Second is that HC is telling us that it has a coverage of 126 reads and only 12 confirming the insertion but it calls as a homozygous insertion. Could you help us to find a direction to understand what is happening please?

Please note that the insertion seq is on the reference genome (b37) and it ends at the start position called by HC.

19 42489516 . A ATGTTCCGAGTCTCCAAGGGGTTGTCGTGC 167.77 . AC=2;AF=1.00;AN=2;DP=126;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;QD=0.05 GT:AD:GQ:PL 1/1:0,12:99:3848,330,0

ins_ex.png
1948 x 1023 - 90K

Best Answer

Answers

Sign In or Register to comment.