Bug Bulletin: we have identified a bug that affects indexing when producing gzipped VCFs. This will be fixed in the upcoming 3.2 release; in the meantime you need to reindex gzipped VCFs using Tabix.

Insertion interpretation

brdidobrdido Posts: 23Member

Hello again,

we are having trouble trying to understand a insertion called by HaplotypeCaller (HC).

First we can't see any read confirming the insertion in IGV.

Second is that HC is telling us that it has a coverage of 126 reads and only 12 confirming the insertion but it calls as a homozygous insertion. Could you help us to find a direction to understand what is happening please?

Please note that the insertion seq is on the reference genome (b37) and it ends at the start position called by HC.

19 42489516 . A ATGTTCCGAGTCTCCAAGGGGTTGTCGTGC 167.77 . AC=2;AF=1.00;AN=2;DP=126;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;QD=0.05 GT:AD:GQ:PL 1/1:0,12:99:3848,330,0

ins_ex.png
1948 x 1023 - 90K

Best Answer

Answers

Sign In or Register to comment.