GATK licensing moves to direct-through-Broad model -- read about it on the GATK blog

Insertion interpretation

brdidobrdido São Paulo - BrazilPosts: 28Member

Hello again,

we are having trouble trying to understand a insertion called by HaplotypeCaller (HC).

First we can't see any read confirming the insertion in IGV.

Second is that HC is telling us that it has a coverage of 126 reads and only 12 confirming the insertion but it calls as a homozygous insertion. Could you help us to find a direction to understand what is happening please?

Please note that the insertion seq is on the reference genome (b37) and it ends at the start position called by HC.

19 42489516 . A ATGTTCCGAGTCTCCAAGGGGTTGTCGTGC 167.77 . AC=2;AF=1.00;AN=2;DP=126;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;QD=0.05 GT:AD:GQ:PL 1/1:0,12:99:3848,330,0

ins_ex.png
1948 x 1023 - 90K

Best Answer

Answers

Sign In or Register to comment.