Error with the HaplotypeCaller when genotyping given alleles

LaurentLaurent Posts: 36Member, GSA Collaborator
edited March 2013 in Ask the GATK team


I have a number of indels that were called using different methods (GATK UG and PINDEL mainly). I am now attempting to genotype them using the GATK HaplotypeCaller and am running into the following error for some variants, e.g.:


The command line I use is:

java -Xmx2g -jar ~/tools/GenomeAnalysisTK-2.4-7-g5e89f01/GenomeAnalysisTK.jar  \
-T HaplotypeCaller \
--genotyping_mode GENOTYPE_GIVEN_ALLELES \
-R /target/gpfs2/gcc/resources/hg19/indices/human_g1k_v37.fa \
-minPruning 5 \
-I /target/gpfs2/gcc/groups/gonl/projects/trio-analysis/intermediate/BQSR2/A102.human_g1k_v37.trio_realigned.recal.bam \
-L 1:1-10000000 \
-L ~/jobs/trio-analysis/ug/comp/hc/ \
-o ~/jobs/trio-analysis/ug/comp/hc/test.out.vcf \
-alleles ~/results/trio-analysis/ug/gonl.merged.ug_pindel_asm_clever.left.biallelic.20bp.N2.vcf 

Any help on how to overcome this would be much appreciated!

Below is the stack trace:

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

java.lang.IllegalStateException: BUG: GenomeLoc 1:768116-768116 has a size == 1 but the variation reference allele has length 21 this = [VC UG_call @ 1:768116 Q136.86 of type=INDEL alleles=[AGTTTTGTTTTGTTTTGTTTT*, A, AGTTTTGTTTTGTTTTGTTTTGTTTT] attr={} GT=[[A102a AGTTTTGTTTTGTTTTGTTTTGTTTT/AGTTTTGTTTTGTTTTGTTTTGTTTT GQ 6 PL 116,6,0,137,21,881],[A102b AGTTTTGTTTTGTTTTGTTTT/AGTTTTGTTTTGTTTTGTTTT GQ 0 PL 0,0,0,3,3,165],[A102c AGTTTTGTTTTGTTTTGTTTTGTTTT/AGTTTTGTTTTGTTTTGTTTTGTTTT GQ 3 PL 45,3,0,60,15,885]] at org.broadinstitute.variant.variantcontext.VariantContext.validateStop( at org.broadinstitute.variant.variantcontext.VariantContext.validate( at org.broadinstitute.variant.variantcontext.VariantContext.( at org.broadinstitute.variant.variantcontext.VariantContextBuilder.make( at org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine.calculateGenotypes( at org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine.calculateGenotypes( at org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine.calculateGenotypes( at org.broadinstitute.sting.gatk.walkers.haplotypecaller.GenotypingEngine.assignGenotypeLikelihoods( at at at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.processActiveRegion( at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.processActiveRegions( at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse( at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse( at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute( at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute( at org.broadinstitute.sting.gatk.CommandLineExecutable.execute( at org.broadinstitute.sting.commandline.CommandLineProgram.start( at org.broadinstitute.sting.commandline.CommandLineProgram.start( at org.broadinstitute.sting.gatk.CommandLineGATK.main(

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.4-3-g2a7af43):
ERROR Please visit the wiki to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions
ERROR MESSAGE: BUG: GenomeLoc 1:768116-768116 has a size == 1 but the variation reference allele has length 21 this = [VC UG_call @ 1:768116 Q136.86 of type=INDEL alleles=[AGTTTTGTTTTGTTTTGTTTT*, A, AGTTTTGTTTTGTTTTGTTTTGTTTT] attr={} GT=[[A102a AGTTTTGTTTTGTTTTGTTTTGTTTT/AGTTTTGTTTTGTTTTGTTTTGTTTT GQ 6 PL 116,6,0,137,21,881],[A102b AGTTTTGTTTTGTTTTGTTTT/AGTTTTGTTTTGTTTTGTTTT GQ 0 PL 0,0,0,3,3,165],[A102c AGTTTTGTTTTGTTTTGTTTTGTTTT/AGTTTTGTTTTGTTTTGTTTTGTTTT GQ 3 PL 45,3,0,60,15,885]]
ERROR ------------------------------------------------------------------------------------------

Edit: Excluding all multi-allelic sites, it seems like I am not getting this type of errors any more. However I am now getting another error on a bi-allelic site. I haven't checked which site it is as the error doesn't specify it but could look into it if you think it is valuable.

Cheers, Laurent

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

java.lang.IllegalStateException: Bad likelihoods detected: 0.009656527453500985 at org.broadinstitute.sting.utils.pairhmm.PairHMM.computeReadLikelihoodGivenHaplotypeLog10( at org.broadinstitute.sting.gatk.walkers.haplotypecaller.LikelihoodCalculationEngine.computeReadLikelihoods( at org.broadinstitute.sting.gatk.walkers.haplotypecaller.LikelihoodCalculationEngine.computeReadLikelihoods( at at at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.processActiveRegion( at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.processActiveRegions( at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse( at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse( at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute( at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute( at org.broadinstitute.sting.gatk.CommandLineExecutable.execute( at org.broadinstitute.sting.commandline.CommandLineProgram.start( at org.broadinstitute.sting.commandline.CommandLineProgram.start( at org.broadinstitute.sting.gatk.CommandLineGATK.main(

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.4-7-g5e89f01):
ERROR Please visit the wiki to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions
ERROR MESSAGE: Bad likelihoods detected: 0.009656527453500985
ERROR ------------------------------------------------------------------------------------------
Post edited by Laurent on

Best Answer


Sign In or Register to comment.