Bug Bulletin: The GenomeLocPArser error in SplitNCigarReads has been fixed; if you encounter it, use the latest nightly build.

"Cannot extend a symbolic allele" when running HaplotypeCaller on Picard Validated bam files

I encounter this error when running HaplotypeCaller on picard-validated bam files using the b37 reference in the GATK resource bundle with GATK v2.3-4-g57ea19f. My commands are : -R resources/BroadInstitute/bundle_1.5/b37/human_g1k_v37.fasta \ -T HaplotypeCaller \ -L 1:233766919-233767204 \ -debug \ -allowPotentiallyMisencodedQuals \ -I sample1.recal.bam -I sample2.recal.bam [...] -I sample36.recal.bam \ -dcov 1200 \ -o samples.3:60800001-60830896.raw.snps.indels.vcf

There was no problem running UnifiedGenotyper on the same data. The stack trace (with debug info) is pasted below.

Any help would be greatly appreciated.

Thanks,

Paige

INFO 14:33:33,576 HelpFormatter - -------------------------------------------------------------------------------- INFO 14:33:33,579 HelpFormatter - The Genome Analysis Toolkit (GATK) v2.3-4-g57ea19f, Compiled 2012/12/20 15:09:50 INFO 14:33:33,579 HelpFormatter - Copyright (c) 2010 The Broad Institute INFO 14:33:33,579 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk INFO 14:33:33,584 HelpFormatter - Program Args: -allowPotentiallyMisencodedQuals -R /scratch1/tmp/tpaige/resources/BroadInstitute/bundle_1.5/b37/human_g1k_v37.fasta -T HaplotypeCaller -L 1:233766919-233767204 -debug -I /scratch0/tmp/tpaige/projects/SRP/6-recal/112_25.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/128_26.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/133_6.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R01_013A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R06_303A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R97_375.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/L01_362.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/L10_440A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R00_113A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R00_294A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R00_421A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R01_210A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R01_489A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R02_217A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R02_363A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R02_449A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R05_304A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R05_449C.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R06_527A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R08_045A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R08_134A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R08_273A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R08_553A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R09_101A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R09_524A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R09_588A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R10_483A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R10_640A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R10_711D.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R96_010A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R97_030B.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R97_051B.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R97_145A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R98_219A.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R98_463E.markdup.realigned.recalibrated.bam -I /scratch0/tmp/tpaige/projects/SRP/6-recal/R98_468D.markdup.realigned.recalibrated.bam -dcov 1200 -o /scratch0/tmp/tpaige/projects/SRP/7-rawVariants/haplotypeCaller/byChr_v3/troubleshoot/SRP.markdup.realigned.recalibrated.haplotypeCaller.1:233766919-233767204.raw.snps.indels.vcf INFO 14:33:33,585 HelpFormatter - Date/Time: 2013/01/02 14:33:33 INFO 14:33:33,585 HelpFormatter - -------------------------------------------------------------------------------- INFO 14:33:33,585 HelpFormatter - -------------------------------------------------------------------------------- INFO 14:33:33,607 GenomeAnalysisEngine - Strictness is SILENT WARN 14:33:33,616 FSLockWithShared - WARNING: Unable to lock file /scratch1/tmp/tpaige/resources/BroadInstitute/bundle_1.5/b37/human_g1k_v37.dict: Function not implemented. INFO 14:33:33,617 ReferenceDataSource - Unable to create a lock on dictionary file: Function not implemented INFO 14:33:33,617 ReferenceDataSource - Treating existing dictionary file as complete. WARN 14:33:33,617 FSLockWithShared - WARNING: Unable to lock file /scratch1/tmp/tpaige/resources/BroadInstitute/bundle_1.5/b37/human_g1k_v37.fasta.fai: Function not implemented. INFO 14:33:33,618 ReferenceDataSource - Unable to create a lock on index file: Function not implemented INFO 14:33:33,618 ReferenceDataSource - Treating existing index file as complete. INFO 14:33:33,815 GenomeAnalysisEngine - Downsampling Settings: Method: BY_SAMPLE, Target Coverage: 1200, Using the new downsampling implementation INFO 14:33:33,823 SAMDataSource$SAMReaders - Initializing SAMRecords in serial INFO 14:33:34,449 SAMDataSource$SAMReaders - Done initializing BAM readers: total time 0.63 INFO 14:33:34,535 GenomeAnalysisEngine - Processing 286 bp from intervals INFO 14:33:34,544 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING] INFO 14:33:34,544 ProgressMeter - Location processed.active regions runtime per.1M.active regions completed total.runtime remaining

Assembling 1:233766919-233767204 with 14701 reads: (with overlap region = 1:233766854-233767269) Found 27 candidate haplotypes to evaluate every read against. TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT

Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAAGATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACGGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGATCGGAAGAGCACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 248M9I168M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGAGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCCTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGGTGGCAAAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 245M7I171M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTAGATCACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 244M1D3M1I168M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGACCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTACCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCTCTTCCGATCTGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 117M11I299M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGATCTATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATCTTTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 119M3I297M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACAATGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 238M2I178M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACAGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATCTGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 110M5D301M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGAGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGACCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAAGGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAAGGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACGGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGAGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAAGGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGAGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAAGGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACGGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAATGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAATGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACGGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAGGATATGAAATGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAGGATATGAAATGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACGGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAATGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M INFO 14:34:04,547 ProgressMeter - 1:233767204 0.00e+00 30.0 s 49.6 w 99.7% 30.1 s 0.1 s INFO 14:34:34,549 ProgressMeter - 1:233767204 0.00e+00 60.0 s 99.2 w 99.7% 60.2 s 0.2 s INFO 14:35:04,553 ProgressMeter - 1:233767204 0.00e+00 90.0 s 148.8 w 99.7% 90.3 s 0.3 s INFO 14:35:34,558 ProgressMeter - 1:233767204 0.00e+00 2.0 m 198.4 w 99.7% 2.0 m 0.4 s INFO 14:36:04,563 ProgressMeter - 1:233767204 0.00e+00 2.5 m 248.0 w 99.7% 2.5 m 0.5 s INFO 14:36:34,568 ProgressMeter - 1:233767204 0.00e+00 3.0 m 297.7 w 99.7% 3.0 m 0.6 s Chose haplotypes 18 and 7 with diploid likelihood = 0.0 Chose haplotypes 18 and 8 with diploid likelihood = -533.747309737968 Chose haplotypes 18 and 0 with diploid likelihood = -777.1108623066011 Chose haplotypes 18 and 1 with diploid likelihood = -1310.8581720445072 Chose haplotypes 7 and 3 with diploid likelihood = -1451.1726611647882 Chose haplotypes 19 and 7 with diploid likelihood = -1501.7146670729999 Chose haplotypes 7 and 4 with diploid likelihood = -1695.1134320870115 Chose haplotypes 17 and 7 with diploid likelihood = -1713.464772552341 Chose haplotypes 8 and 3 with diploid likelihood = -1984.9199709026507 Chose haplotypes 8 and 4 with diploid likelihood = -2228.860741824894 Chose haplotypes 19 and 0 with diploid likelihood = -2278.8255293794828 Chose haplotypes 17 and 0 with diploid likelihood = -2490.5756348588693 Chose haplotypes 20 and 7 with diploid likelihood = -2585.3380487913055 Chose haplotypes 20 and 0 with diploid likelihood = -3362.448911097821 Chose haplotypes 21 and 7 with diploid likelihood = -3483.4850108307965 Chose haplotypes 15 and 7 with diploid likelihood = -3568.629541037797 Chose haplotypes 16 and 7 with diploid likelihood = -3777.6186484047903 Chose 12 alternate haplotypes to genotype in all samples. === Best Haplotypes === TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (0 , 0)

Events = {} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAAGGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (0 , 0) Events = {233767008=[VC HC1 @ 1:233767008 Q. of type=SNP alleles=[T*, A] attr={} GT=[], 233767023=[VC HC1 @ 1:233767023 Q. of type=SNP alleles=[A*, G] attr={} GT=[], 233767059=[VC HC1 @ 1:233767059 Q. of type=SNP alleles=[T*, C] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAAGGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACGGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (0 , 274) Events = {233767008=[VC HC2 @ 1:233767008 Q. of type=SNP alleles=[T*, A] attr={} GT=[], 233767023=[VC HC2 @ 1:233767023 Q. of type=SNP alleles=[A*, G] attr={} GT=[], 233767059=[VC HC2 @ 1:233767059 Q. of type=SNP alleles=[T*, C] attr={} GT=[], 233767105=[VC HC2 @ 1:233767105 Q. of type=SNP alleles=[A*, G] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGAGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAAGGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (104 , 0) Events = {233767008=[VC HC3 @ 1:233767008 Q. of type=SNP alleles=[T*, A] attr={} GT=[], 233767023=[VC HC3 @ 1:233767023 Q. of type=SNP alleles=[A*, G] attr={} GT=[], 233767059=[VC HC3 @ 1:233767059 Q. of type=SNP alleles=[T*, C] attr={} GT=[], 233766958=[VC HC3 @ 1:233766958 Q. of type=SNP alleles=[C*, A] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGAGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGATTCTGACAACATCAGGATATGAAAGGTTGTCACTCACTGAACCCCTAATGCGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACGGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (104 , 274) Events = {233767008=[VC HC4 @ 1:233767008 Q. of type=SNP alleles=[T*, A] attr={} GT=[], 233767023=[VC HC4 @ 1:233767023 Q. of type=SNP alleles=[A*, G] attr={} GT=[], 233767059=[VC HC4 @ 1:233767059 Q. of type=SNP alleles=[T*, C] attr={} GT=[], 233767105=[VC HC4 @ 1:233767105 Q. of type=SNP alleles=[A*, G] attr={} GT=[], 233766958=[VC HC4 @ 1:233766958 Q. of type=SNP alleles=[C*, A] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGAGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (104 , 0) Events = {233766958=[VC HC5 @ 1:233766958 Q. of type=SNP alleles=[C*, A] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACGGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (0 , 0) Events = {233767105=[VC HC6 @ 1:233767105 Q. of type=SNP alleles=[A*, G] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCCTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (105 , 0) Events = {233766959=[VC HC7 @ 1:233766959 Q. of type=SNP alleles=[G*, C] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGACACAAGATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (0 , 256) Events = {233767107=[VC HC8 @ 1:233767107 Q. of type=SNP alleles=[A*, G] attr={} GT=[], 233767106=[VC HC8 @ 1:233767106 Q. of type=SNP alleles=[G*, A] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGAGATCGGAAGAGCACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 248M9I168M Left and right breaks = (0 , 258) Events = {233767101=[VC HC9 @ 1:233767101 Q. of type=SYMBOLIC alleles=[A*, ] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTGGTGGCAAAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 245M7I171M Left and right breaks = (0 , 253) Events = {233767098=[VC HC10 @ 1:233767098 Q. of type=SYMBOLIC alleles=[G*, ] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGACCTGAGACACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 416M Left and right breaks = (0 , 241) Events = {233767094=[VC HC11 @ 1:233767094 Q. of type=SNP alleles=[C*, A] attr={} GT=[]} TTCTGACAAGGAAAAGACCGTGCCTCATCTCTGGCTCTCAGAATTGTCCATCATCCACAGTCTATTTTATTTATACCTACGTGGTAACTGCTAACTCAAATAGGCGTGATGGTGACCGATTATCATTGTGTTTCCCTTTGCCACCAGGTGCGGGTTTCTGACAACATCAAGATATGAAAGGTTGTCACTCACTGAACCCCTAATGTGTGTTTAACTGTTGGGGAAGAATGGGAATCACTGCCCTAGATCACAGAATTTAATTAGGCCTGCTTCTTTGTGTTTCTCTTTAATGATAGGATTTTAAGCTCAACGGTTATCAGCTCAAAAGCAGAAAATGTTCATTCCCGTTTGTGCCCTGGTATCTTGAAGAATGTGCAATAGGTGAGCTTGCCATTAATCTAACTGAATTTCTCCCT Cigar = 244M1D3M1I168M Left and right breaks = (0 , 249) Events = {233767097=[VC HC12 @ 1:233767097-233767098 Q. of type=INDEL alleles=[TG*, T] attr={} GT=[], 233767101=[VC HC12 @ 1:233767101 Q. of type=INDEL alleles=[A*, AT] attr={} GT=[]} Found consecutive biallelic events with R^2 = 0.0303 -- [VC HC3 @ 1:233766958 Q. of type=SNP alleles=[C*, A] attr={} GT=[] -- [VC HC7 @ 1:233766959 Q. of type=SNP alleles=[G*, C] attr={} GT=[] Found consecutive biallelic events with R^2 = 0.0083 -- [VC HC11 @ 1:233767094 Q. of type=SNP alleles=[C*, A] attr={} GT=[] -- [VC HC12 @ 1:233767097-233767098 Q. of type=INDEL alleles=[TG*, T] attr={} GT=[] Found consecutive biallelic events with R^2 = 1.0000 -- [VC HC12 @ 1:233767097-233767098 Q. of type=INDEL alleles=[TG*, T] attr={} GT=[] -- [VC HC12 @ 1:233767101 Q. of type=INDEL alleles=[A*, AT] attr={} GT=[] ====> [VC merged @ 1:233767098-233767101 Q. of type=MNP alleles=[GAGA*, AGAT] attr={} GT=[] Found consecutive biallelic events with R^2 = 0.0303 -- [VC HC3 @ 1:233766958 Q. of type=SNP alleles=[C*, A] attr={} GT=[] -- [VC HC7 @ 1:233766959 Q. of type=SNP alleles=[G*, C] attr={} GT=[] Found consecutive biallelic events with R^2 = 0.0182 -- [VC HC11 @ 1:233767094 Q. of type=SNP alleles=[C*, A] attr={} GT=[] -- [VC merged @ 1:233767098-233767101 Q. of type=MNP alleles=[GAGA*, AGAT] attr={} GT=[] Found consecutive biallelic events with R^2 = 0.0667 -- [VC merged @ 1:233767098-233767101 Q. of type=MNP alleles=[GAGA*, AGAT] attr={} GT=[] -- [VC HC2 @ 1:233767105 Q. of type=SNP alleles=[A*, G] attr={} GT=[] Found consecutive biallelic events with R^2 = 0.0303 -- [VC HC2 @ 1:233767105 Q. of type=SNP alleles=[A*, G] attr={} GT=[] -- [VC HC8 @ 1:233767106 Q. of type=SNP alleles=[G*, A] attr={} GT=[] Found consecutive biallelic events with R^2 = 1.0000 -- [VC HC8 @ 1:233767106 Q. of type=SNP alleles=[G*, A] attr={} GT=[] -- [VC HC8 @ 1:233767107 Q. of type=SNP alleles=[A*, G] attr={} GT=[] ====> [VC merged @ 1:233767106-233767107 Q. of type=MNP alleles=[GA*, AG] attr={} GT=[] Found consecutive biallelic events with R^2 = 0.0303 -- [VC HC3 @ 1:233766958 Q. of type=SNP alleles=[C*, A] attr={} GT=[] -- [VC HC7 @ 1:233766959 Q. of type=SNP alleles=[G*, C] attr={} GT=[] Found consecutive biallelic events with R^2 = 0.0182 -- [VC HC11 @ 1:233767094 Q. of type=SNP alleles=[C*, A] attr={} GT=[] -- [VC merged @ 1:233767098-233767101 Q. of type=MNP alleles=[GAGA*, AGAT] attr={} GT=[] Found consecutive biallelic events with R^2 = 0.0667 -- [VC merged @ 1:233767098-233767101 Q. of type=MNP alleles=[GAGA*, AGAT] attr={} GT=[] -- [VC HC2 @ 1:233767105 Q. of type=SNP alleles=[A*, G] attr={} GT=[] Found consecutive biallelic events with R^2 = 0.0303 -- [VC HC2 @ 1:233767105 Q. of type=SNP alleles=[A*, G] attr={} GT=[] -- [VC merged @ 1:233767106-233767107 Q. of type=MNP alleles=[GA*, AG] attr={} GT=[] Genotyping event at 233766958 with alleles = [C*, A] Genotyping event at 233766959 with alleles = [G*, C] Genotyping event at 233767008 with alleles = [T*, A] Genotyping event at 233767023 with alleles = [A*, G] Genotyping event at 233767059 with alleles = [T*, C] Genotyping event at 233767094 with alleles = [C*, A] INFO 14:36:57,341 GATKRunReport - Uploaded run statistics report to AWS S3

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

java.lang.IllegalArgumentException: Cannot extend a symbolic allele at org.broadinstitute.sting.utils.variantcontext.Allele.extend(Allele.java:182) at org.broadinstitute.sting.utils.variantcontext.VariantContextUtils.resolveIncompatibleAlleles(VariantContextUtils.java:842) at org.broadinstitute.sting.utils.variantcontext.VariantContextUtils.simpleMerge(VariantContextUtils.java:545) at org.broadinstitute.sting.utils.variantcontext.VariantContextUtils.simpleMerge(VariantContextUtils.java:452) at org.broadinstitute.sting.gatk.walkers.haplotypecaller.GenotypingEngine.assignGenotypeLikelihoodsAndCallIndependentEvents(GenotypingEngine.java:159) at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:411) at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:107) at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.processActiveRegion(TraverseActiveRegions.java:285) at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.callWalkerMapOnActiveRegions(TraverseActiveRegions.java:230) at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.processActiveRegions(TraverseActiveRegions.java:205) at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.endTraversal(TraverseActiveRegions.java:294) at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:93) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:281) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:237) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:147) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:94)

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.3-4-g57ea19f):
ERROR
ERROR Please visit the wiki to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: Cannot extend a symbolic allele
ERROR ------------------------------------------------------------------------------------------

Answers

Sign In or Register to comment.