Different annotations for same co-ordinates in vcf

tinutinu Posts: 31Member
edited January 2013 in Ask the GATK team

Please look at lines 1 and 2 taken from a vcf file, which have same Chromosome and Position and one of the Alt allele is same in both lines, different allele count and have different rsID.

1 1229111 rs70949568 A ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC,C 2629.32 TruthSensitivityTranche99.50to99.90;TruthSensitivityTranche99.30to99.50 AC=80,31;AF=0.1273;AN=284;BaseQRankSum=1.124;DB;DP=426;Dels=0.00;FS=4.620;HRun=1;HaplotypeScore=0.2101;InbreedingCoeff=-0.0029;MQ0=0;MQ=58.46;MQRankSum=1.211;QD=5.26;ReadPosRankSum=-5.748;SB=-36.94;SF=0f,1f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-2.3894;culprit=MQ GT:DP:GQ:AD:PL

1 1229111 . A C 89.94 TruthSensitivityTranche99.00to99.30 AC=7;AF=0.0614;AN=114;BaseQRankSum=0.801;DP=175;Dels=0.00;FS=1.668;HRun=1;HaplotypeScore=0.2276;InbreedingCoeff=-0.0538;MQ0=0;MQ=57.90;MQRankSum=0.501;QD=4.28;ReadPosRankSum=-4.531;SB=-15.19;SF=0f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-1.4433;culprit=MQ GT:DP:GQ:AD:PL

Post edited by Geraldine_VdAuwera on
Tagged:

Best Answer

Answers

  • pdexheimerpdexheimer Posts: 385Member, GSA Collaborator ✭✭✭
  • tinutinu Posts: 31Member

    Thanks.

    But my doubt is according to the lines mentioned, for rs70949568 there are 2 Alternate Alleles (ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC and C). The Alternate Allele 'C' for rs70949568 fmeans that it is a SNP which changes from Ref Allele 'A' to 'C'

    Now for the second line which is the same Chr and Pos repeated again in the same vcf, the Alternate Allele is again C, which was mentioned as one of the Ref allele for rs70949568 and both lines have same Ref Allele.

    So my doubt is why should we have same change A to C mentioned in 2 lines.

Sign In or Register to comment.