Different annotations for same co-ordinates in vcf

tinu

Please look at lines 1 and 2 taken from a vcf file, which have same Chromosome and Position and one of the Alt allele is same in both lines, different allele count and have different rsID.

1 1229111 rs70949568 A ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC,C 2629.32 TruthSensitivityTranche99.50to99.90;TruthSensitivityTranche99.30to99.50 AC=80,31;AF=0.1273;AN=284;BaseQRankSum=1.124;DB;DP=426;Dels=0.00;FS=4.620;HRun=1;HaplotypeScore=0.2101;InbreedingCoeff=-0.0029;MQ0=0;MQ=58.46;MQRankSum=1.211;QD=5.26;ReadPosRankSum=-5.748;SB=-36.94;SF=0f,1f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-2.3894;culprit=MQ GT:DP:GQ:AD:PL

1 1229111 . A C 89.94 TruthSensitivityTranche99.00to99.30 AC=7;AF=0.0614;AN=114;BaseQRankSum=0.801;DP=175;Dels=0.00;FS=1.668;HRun=1;HaplotypeScore=0.2276;InbreedingCoeff=-0.0538;MQ0=0;MQ=57.90;MQRankSum=0.501;QD=4.28;ReadPosRankSum=-4.531;SB=-15.19;SF=0f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-1.4433;culprit=MQ GT:DP:GQ:AD:PL

pdexheimer

No, I think you're looking at it backwards. The annotation tells you whether the variation in the VCF file is known. When there are multiple alleles, you have a potential conflict when one of the alternate alleles is known and another is not. So in this case, you have a known variation - the insertion - and an unknown variation - the transversion. Since there's a known variation present, it gets annotated.

You then have a separate file which has only the unknown transversion. Since nothing there matches the known variation, it's (properly) not associated with an rs id.

pdexheimer

The annotations are correct, rs70949568 is the insertion in Line 1: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=70949568

tinu

Thanks.

But my doubt is according to the lines mentioned, for rs70949568 there are 2 Alternate Alleles (ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC and C). The Alternate Allele 'C' for rs70949568 fmeans that it is a SNP which changes from Ref Allele 'A' to 'C'

Now for the second line which is the same Chr and Pos repeated again in the same vcf, the Alternate Allele is again C, which was mentioned as one of the Ref allele for rs70949568 and both lines have same Ref Allele.

So my doubt is why should we have same change A to C mentioned in 2 lines.