Collected FAQs about BAM files

Geraldine_VdAuweraGeraldine_VdAuwera Posts: 2,484Administrator, GSA Official Member admin
edited March 5 in FAQs

1. What file formats do you support for sequencer output?

The GATK supports the BAM format for reads, quality scores, alignments, and metadata (e.g. the lane of sequencing, center of origin, sample name, etc.). No other file formats are supported.

2. How do I get my data into BAM format?

The GATK doesn't have any tools for getting data into BAM format, but many other toolkits exist for this purpose. We recommend you look at Picard and Samtools for creating and manipulating BAM files. Also, many aligners are starting to emit BAM files directly. See BWA for one such aligner.

3. What are the formatting requirements for my BAM file(s)?

All BAM files must satisfy the following requirements:

  • It must be aligned to one of the references described here.
  • It must be sorted in coordinate order (not by queryname and not "unsorted").
  • It must list the read groups with sample names in the header.
  • Every read must belong to a read group.
  • The BAM file must pass Picard validation.

See the BAM specification for more information.

4. What is the canonical ordering of human reference contigs in a BAM file?

It depends on whether you're using the NCBI/GRC build 36/build 37 version of the human genome, or the UCSC hg18/hg19 version of the human genome. While substantially equivalent, the naming conventions are different. The canonical ordering of contigs for these genomes is as follows:

Human genome reference consortium standard ordering and names (b3x): 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, Y, MT...

UCSC convention (hg1x): chrM, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9, chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18, chr19, chr20, chr21, chr22, chrX, chrY...

5. How can I tell if my BAM file is sorted properly?

The easiest way to do it is to download Samtools and run the following command to examine the header of your file:

$ samtools view -H /path/to/my.bam
@HD     VN:1.0  GO:none SO:coordinate
@SQ     SN:1    LN:247249719
@SQ     SN:2    LN:242951149
@SQ     SN:3    LN:199501827
@SQ     SN:4    LN:191273063
@SQ     SN:5    LN:180857866
@SQ     SN:6    LN:170899992
@SQ     SN:7    LN:158821424
@SQ     SN:8    LN:146274826
@SQ     SN:9    LN:140273252
@SQ     SN:10   LN:135374737
@SQ     SN:11   LN:134452384
@SQ     SN:12   LN:132349534
@SQ     SN:13   LN:114142980
@SQ     SN:14   LN:106368585
@SQ     SN:15   LN:100338915
@SQ     SN:16   LN:88827254
@SQ     SN:17   LN:78774742
@SQ     SN:18   LN:76117153
@SQ     SN:19   LN:63811651
@SQ     SN:20   LN:62435964
@SQ     SN:21   LN:46944323
@SQ     SN:22   LN:49691432
@SQ     SN:X    LN:154913754
@SQ     SN:Y    LN:57772954
@SQ     SN:MT   LN:16571
@SQ     SN:NT_113887    LN:3994
...

If the order of the contigs here matches the contig ordering specified above, and the SO:coordinate flag appears in your header, then your contig and read ordering satisfies the GATK requirements.

6. My BAM file isn't sorted that way. How can I fix it?

Picard offers a tool called SortSam that will sort a BAM file properly. A similar utility exists in Samtools, but we recommend the Picard tool because SortSam will also set a flag in the header that specifies that the file is correctly sorted, and this flag is necessary for the GATK to know it is safe to process the data. Also, you can use the ReorderSam command to make a BAM file SQ order match another reference sequence.

7. How can I tell if my BAM file has read group and sample information?

A quick Unix command using Samtools will do the trick:

$ samtools view -H /path/to/my.bam | grep '^@RG'
@RG ID:0    PL:solid    PU:Solid0044_20080829_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP   LB:Lib1 PI:2750 DT:2008-08-28T20:00:00-0400 SM:NA12414  CN:bcm
@RG ID:1    PL:solid    PU:0083_BCM_20080719_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP    LB:Lib1 PI:2750 DT:2008-07-18T20:00:00-0400 SM:NA12414  CN:bcm
@RG ID:2    PL:LS454    PU:R_2008_10_02_06_06_12_FLX01080312_retry  LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC
@RG ID:3    PL:LS454    PU:R_2008_10_02_06_07_08_rig19_retry    LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC
@RG ID:4    PL:LS454    PU:R_2008_10_02_17_50_32_FLX03080339_retry  LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC
...

The presence of the @RG tags indicate the presence of read groups. Each read group has a SM tag, indicating the sample from which the reads belonging to that read group originate.

In addition to the presence of a read group in the header, each read must belong to one and only one read group. Given the following example reads,

$ samtools view /path/to/my.bam | grep '^@RG'
EAS139_44:2:61:681:18781    35  1   1   0   51M =   9   59  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA B<>;==?=?<==?=?=>>?>><=<?=?8<=?>?<:=?>?<==?=>:;<?:= RG:Z:4  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31
EAS139_44:7:84:1300:7601    35  1   1   0   51M =   12  62  TAACCCTAAGCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA G<>;==?=?&=>?=?<==?>?<>>?=?<==?>?<==?>?1==@>?;<=><; RG:Z:3  MF:i:18 Aq:i:0  NM:i:1  UQ:i:5  H0:i:0  H1:i:85
EAS139_44:8:59:118:13881    35  1   1   0   51M =   2   52  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>;<=?=?==>?>?<==?=><=>?-?;=>?:><==?7?;<>?5?<<=>:; RG:Z:1  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31
EAS139_46:3:75:1326:2391    35  1   1   0   51M =   12  62  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>==>?>@???B>A>?>A?A>??A?@>?@A?@;??A>@7>?>>@:>=@;@ RG:Z:0  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31
...

membership in a read group is specified by the RG:Z:* tag. For instance, the first read belongs to read group 4 (sample NA11881), while the last read shown here belongs to read group 0 (sample NA12414).

8. My BAM file doesn't have read group and sample information. Do I really need it?

Yes! Many algorithms in the GATK need to know that certain reads were sequenced together on a specific lane, as they attempt to compensate for variability from one sequencing run to the next. Others need to know that the data represents not just one, but many samples. Without the read group and sample information, the GATK has no way of determining this critical information.

9. What's the meaning of the standard read group fields?

For technical details, see the SAM specification on the Samtools website.

Tag Importance SAM spec definition Meaning
ID Required Read group identifier. Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section. Read groupIDs may be modified when merging SAM files in order to handle collisions. Ideally, this should be a globally unique identify across all sequencing data in the world, such as the Illumina flowcell + lane name and number. Will be referenced by each read with the RG:Z field, allowing tools to determine the read group information associated with each read, including the sample from which the read came. Also, a read group is effectively treated as a separate run of the NGS instrument in tools like base quality score recalibration -- all reads within a read group are assumed to come from the same instrument run and to therefore share the same error model.
SM Sample. Use pool name where a pool is being sequenced. Required. As important as ID. The name of the sample sequenced in this read group. GATK tools treat all read groups with the same SM value as containing sequencing data for the same sample. Therefore it's critical that the SM field be correctly specified, especially when using multi-sample tools like the Unified Genotyper.
PL Platform/technology used to produce the read. Valid values: ILLUMINA, SOLID, LS454, HELICOS and PACBIO. Important. Not currently used in the GATK, but was in the past, and may return. The only way to known the sequencing technology used to generate the sequencing data . It's a good idea to use this field.
LB DNA preparation library identify Essential for MarkDuplicates MarkDuplicates uses the LB field to determine which read groups might contain molecular duplicates, in case the same DNA library was sequenced on multiple lanes.

We do not require value for the CN, DS, DT, PG, PI, or PU fields.

A concrete example may be instructive. Suppose I have a trio of samples: MOM, DAD, and KID. Each has two DNA libraries prepared, one with 400 bp inserts and another with 200 bp inserts. Each of these libraries is run on two lanes of an Illumina HiSeq, requiring 3 x 2 x 2 = 12 lanes of data. When the data come off the sequencer, I would create 12 bam files, with the following @RG fields in the header:

Dad's data:
@RG     ID:FLOWCELL1.LANE1      PL:ILLUMINA     LB:LIB-DAD-1 SM:DAD      PI:200
@RG     ID:FLOWCELL1.LANE2      PL:ILLUMINA     LB:LIB-DAD-1 SM:DAD      PI:200
@RG     ID:FLOWCELL1.LANE3      PL:ILLUMINA     LB:LIB-DAD-2 SM:DAD      PI:400
@RG     ID:FLOWCELL1.LANE4      PL:ILLUMINA     LB:LIB-DAD-2 SM:DAD      PI:400

Mom's data:
@RG     ID:FLOWCELL1.LANE5      PL:ILLUMINA     LB:LIB-MOM-1 SM:MOM      PI:200
@RG     ID:FLOWCELL1.LANE6      PL:ILLUMINA     LB:LIB-MOM-1 SM:MOM      PI:200
@RG     ID:FLOWCELL1.LANE7      PL:ILLUMINA     LB:LIB-MOM-2 SM:MOM      PI:400
@RG     ID:FLOWCELL1.LANE8      PL:ILLUMINA     LB:LIB-MOM-2 SM:MOM      PI:400

Kid's data:
@RG     ID:FLOWCELL2.LANE1      PL:ILLUMINA     LB:LIB-KID-1 SM:KID      PI:200
@RG     ID:FLOWCELL2.LANE2      PL:ILLUMINA     LB:LIB-KID-1 SM:KID      PI:200
@RG     ID:FLOWCELL2.LANE3      PL:ILLUMINA     LB:LIB-KID-2 SM:KID      PI:400
@RG     ID:FLOWCELL2.LANE4      PL:ILLUMINA     LB:LIB-KID-2 SM:KID      PI:400

Note the hierarchical relationship between read groups (unique for each lane) to libraries (sequenced on two lanes) and samples (across four lanes, two lanes for each library).

9. My BAM file doesn't have read group and sample information. How do I add it?

Use Picard's AddOrReplaceReadGroups tool to add read group information.

10. How do I know if my BAM file is valid?

Picard contains a tool called ValidateSamFile that can be used for this. BAMs passing STRICT validation stringency work best with the GATK.

11. What's the best way to create a subset of my BAM file containing only reads over a small interval?

You can use the GATK to do the following:

GATK -I full.bam -T PrintReads -L chr1:10-20 -o subset.bam

and you'll get a BAM file containing only reads overlapping those points. This operation retains the complete BAM header from the full file (this was the reference aligned to, after all) so that the BAM remains easy to work with. We routinely use these features for testing and high-performance analysis with the GATK.

Post edited by Geraldine_VdAuwera on

Geraldine Van der Auwera, PhD

Comments

Sign In or Register to comment.