Service note: Geraldine is on vacation this week; other members of GSA will be responding to questions, but they have a lot of work besides this, so be aware that responses may be a little slower than usual. Thank you for your patience.

What input files does the GATK accept?

Geraldine_VdAuweraGeraldine_VdAuwera Posts: 2,238Administrator, GSA Official Member admin

1. Reference Sequence

The GATK requires the reference sequence in a single reference sequence in FASTA format, with all contigs in the same file. The GATK requires strict adherence to the FASTA standard. Only the standard ACGT bases are accepted; no non-standard bases (W, for example) are tolerated. Gzipped fasta files will not work with the GATK, so please make sure to unzip them first. Please see this article for more information on preparing FASTA reference sequences for use with the GATK.

Human sequence

If you are using human data, your reads must be aligned to one of the official b3x (e.g. b36, b37) or hg1x (e.g. hg18, hg19) references. The contig ordering in the reference you used must exactly match that of one of the official references canonical orderings. These are defined by historical karotyping of largest to smallest chromosomes, followed by the X, Y, and MT for the b3x references; the order is thus 1, 2, 3, ..., 10, 11, 12, ... 20, 21, 22, X, Y, MT. The hg1x references differ in that the chromosome names are prefixed with "chr" and chrM appears first instead of last. The GATK will detect misordered contigs (for example, lexicographically sorted) and throw an error. This draconian approach, though unnecessary technically, ensures that all supplementary data provided with the GATK works correctly. You can use ReorderSam to fix a BAM file aligned to a missorted reference sequence.

Our Best Practice recommendation is that you use a standard GATK reference from the GATK resource bundle.

2. Sequencing Reads

The only input format for NGS reads that the GATK supports is the [Sequence Alignment/Map (SAM)] format. See [SAM/BAM] for more details on the SAM/BAM format as well as Samtools and Picard, two complementary sets of utilities for working with SAM/BAM files.

In addition to being in SAM format, we require the following additional constraints in order to use your file with the GATK:

  • The file must be binary (with .bam file extension).
  • The file must be indexed.
  • The file must be sorted in coordinate order with respect to the reference (i.e. the contig ordering in your bam must exactly match that of the reference you are using).
  • The file must have a proper bam header with read groups. Each read group must contain the platform (PL) and sample (SM) tags. For the platform value, we currently support 454, LS454, Illumina, Solid, ABI_Solid, and CG (all case-insensitive).
  • Each read in the file must be associated with exactly one read group.

Below is an example well-formed SAM field header and fields from the 1000 Genomes Project:

@HD     VN:1.0  GO:none SO:coordinate
@SQ     SN:1    LN:249250621    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1b22b98cdeb4a9304cb5d48026a85128
@SQ     SN:2    LN:243199373    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:a0d9851da00400dec1098a9255ac712e
@SQ     SN:3    LN:198022430    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:fdfd811849cc2fadebc929bb925902e5
@SQ     SN:4    LN:191154276    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:23dccd106897542ad87d2765d28a19a1
@SQ     SN:5    LN:180915260    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:0740173db9ffd264d728f32784845cd7
@SQ     SN:6    LN:171115067    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1d3a93a248d92a729ee764823acbbc6b
@SQ     SN:7    LN:159138663    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:618366e953d6aaad97dbe4777c29375e
@SQ     SN:8    LN:146364022    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:96f514a9929e410c6651697bded59aec
@SQ     SN:9    LN:141213431    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:3e273117f15e0a400f01055d9f393768
@SQ     SN:10   LN:135534747    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:988c28e000e84c26d552359af1ea2e1d
@SQ     SN:11   LN:135006516    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:98c59049a2df285c76ffb1c6db8f8b96
@SQ     SN:12   LN:133851895    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:51851ac0e1a115847ad36449b0015864
@SQ     SN:13   LN:115169878    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:283f8d7892baa81b510a015719ca7b0b
@SQ     SN:14   LN:107349540    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:98f3cae32b2a2e9524bc19813927542e
@SQ     SN:15   LN:102531392    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:e5645a794a8238215b2cd77acb95a078
@SQ     SN:16   LN:90354753     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:fc9b1a7b42b97a864f56b348b06095e6
@SQ     SN:17   LN:81195210     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:351f64d4f4f9ddd45b35336ad97aa6de
@SQ     SN:18   LN:78077248     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:b15d4b2d29dde9d3e4f93d1d0f2cbc9c
@SQ     SN:19   LN:59128983     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1aacd71f30db8e561810913e0b72636d
@SQ     SN:20   LN:63025520     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:0dec9660ec1efaaf33281c0d5ea2560f
@SQ     SN:21   LN:48129895     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:2979a6085bfe28e3ad6f552f361ed74d
@SQ     SN:22   LN:51304566     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:a718acaa6135fdca8357d5bfe94211dd
@SQ     SN:X    LN:155270560    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:7e0e2e580297b7764e31dbc80c2540dd
@SQ     SN:Y    LN:59373566     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1fa3474750af0948bdf97d5a0ee52e51
@SQ     SN:MT   LN:16569        AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:c68f52674c9fb33aef52dcf399755519
@RG     ID:ERR000162    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR000252    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001684    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001685    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001686    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001687    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001688    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001689    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001690    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002307    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002308    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002309    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002310    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002311    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002312    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002313    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002434    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@PG     ID:GATK TableRecalibration      VN:v2.2.16      CL:Covariates=[ReadGroupCovariate, QualityScoreCovariate, DinucCovariate, CycleCovariate], use_original_quals=true, defau 
t_read_group=DefaultReadGroup, default_platform=Illumina, force_read_group=null, force_platform=null, solid_recal_mode=SET_Q_ZERO, window_size_nqs=5, homopolymer_nback=7, except on_if_no_tile=false, pQ=5, maxQ=40, smoothing=137       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:b4eb71ee878d3706246b7c1dbef69299
@PG     ID:bwa  VN:0.5.5
ERR001685.4315085       16      1       9997    25      35M     *       0       0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     ?8:C7ACAABBCBAAB?CCAABBEBA@ACEBBB@?     XT:A:U  XN:i:4    X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001685  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:>>:>2>>>>>>>>>>>>>>>>>>?>>>>??>???>
ERR001689.1165834       117     1       9997    0       *       =       9997    0       CCGATCTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     >7AA<@@C?@?B?B??>9?B??>A?B???BAB??@     RG:Z:ERR001689    OQ:Z:>:<<8<<<><<><><<>7<>>>?>>??>???????
ERR001689.1165834       185     1       9997    25      35M     =       9997    0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     758A:?>>8?=@@>>?;4<>=??@@==??@?==?8     XT:A:U  XN:i:4    SM:i:25 AM:i:0  X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001689  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:;74>7><><><>>>>><:<>>>>>>>>>>>>>>>>
ERR001688.2681347       117     1       9998    0       *       =       9998    0       CGATCTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     5@BA@A6B???A?B??>B@B??>B@B??>BAB???     RG:Z:ERR001688    OQ:Z:=>>>><4><<?><??????????????????????       

Fixing BAM files with alternative sortings

The GATK requires that the BAM file be sorted in the same order as the reference. Unfortunately, many BAM files have headers that are sorted in some other order -- lexicographical order is a common alternative. To resort the BAM file please use ReorderSam.

3. Intervals

The GATK accept interval files for processing subsets of the genome in Picard-style interval lists. These files have a .interval_list extension and look like this:

@HD     VN:1.0  SO:coordinate
@SQ     SN:1    LN:249250621    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1b22b98cdeb4a9304cb5d48026a85128     SP:Homo Sapiens
@SQ     SN:2    LN:243199373    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:a0d9851da00400dec1098a9255ac712e     SP:Homo Sapiens
@SQ     SN:3    LN:198022430    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:fdfd811849cc2fadebc929bb925902e5     SP:Homo Sapiens
@SQ     SN:4    LN:191154276    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:23dccd106897542ad87d2765d28a19a1     SP:Homo Sapiens
@SQ     SN:5    LN:180915260    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:0740173db9ffd264d728f32784845cd7     SP:Homo Sapiens
@SQ     SN:6    LN:171115067    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1d3a93a248d92a729ee764823acbbc6b     SP:Homo Sapiens
@SQ     SN:7    LN:159138663    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:618366e953d6aaad97dbe4777c29375e     SP:Homo Sapiens
@SQ     SN:8    LN:146364022    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:96f514a9929e410c6651697bded59aec     SP:Homo Sapiens
@SQ     SN:9    LN:141213431    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:3e273117f15e0a400f01055d9f393768     SP:Homo Sapiens
@SQ     SN:10   LN:135534747    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:988c28e000e84c26d552359af1ea2e1d     SP:Homo Sapiens
@SQ     SN:11   LN:135006516    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:98c59049a2df285c76ffb1c6db8f8b96     SP:Homo Sapiens
@SQ     SN:12   LN:133851895    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:51851ac0e1a115847ad36449b0015864     SP:Homo Sapiens
@SQ     SN:13   LN:115169878    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:283f8d7892baa81b510a015719ca7b0b     SP:Homo Sapiens
@SQ     SN:14   LN:107349540    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:98f3cae32b2a2e9524bc19813927542e     SP:Homo Sapiens
@SQ     SN:15   LN:102531392    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:e5645a794a8238215b2cd77acb95a078     SP:Homo Sapiens
@SQ     SN:16   LN:90354753     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:fc9b1a7b42b97a864f56b348b06095e6     SP:Homo Sapiens
@SQ     SN:17   LN:81195210     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:351f64d4f4f9ddd45b35336ad97aa6de     SP:Homo Sapiens
@SQ     SN:18   LN:78077248     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:b15d4b2d29dde9d3e4f93d1d0f2cbc9c     SP:Homo Sapiens
@SQ     SN:19   LN:59128983     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1aacd71f30db8e561810913e0b72636d     SP:Homo Sapiens
@SQ     SN:20   LN:63025520     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:0dec9660ec1efaaf33281c0d5ea2560f     SP:Homo Sapiens
@SQ     SN:21   LN:48129895     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:2979a6085bfe28e3ad6f552f361ed74d     SP:Homo Sapiens
@SQ     SN:22   LN:51304566     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:a718acaa6135fdca8357d5bfe94211dd     SP:Homo Sapiens
@SQ     SN:X    LN:155270560    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:7e0e2e580297b7764e31dbc80c2540dd     SP:Homo Sapiens
@SQ     SN:Y    LN:59373566     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1fa3474750af0948bdf97d5a0ee52e51     SP:Homo Sapiens
@SQ     SN:MT   LN:16569        AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:c68f52674c9fb33aef52dcf399755519     SP:Homo Sapiens
1       30366   30503   +       target_1
1       69089   70010   +       target_2
1       367657  368599  +       target_3
1       621094  622036  +       target_4
1       861320  861395  +       target_5
1       865533  865718  +       target_6
...

consisting of a SAM-file-like sequence dictionary (the header), and targets in the form of + . These interval lists are tab-delimited. They are also 1-based (first position in the genome is position 1, not position 0). The easiest way to create such a file is to combine your reference file's sequence dictionary (the file stored alongside the reference fasta file with the .dict extension) and your intervals into one file.

You can also specify a list of intervals in a .interval_list file formatted as :- (one interval per line). No sequence dictionary is necessary. This file uses 1-based coordinates.

Finally, we also accept BED style interval lists. Warning: this file format is 0-based for the start coordinates, so coordinates taken from 1-based formats should be offset by 1.

4. Reference Ordered Data (ROD) file formats

The GATK can associate arbitrary reference ordered data (ROD) files with named tracks for all tools. Some tools require specific ROD data files for processing, and developers are free to write tools that access arbitrary data sets using the ROD interface. The general ROD system has the following syntax:

-argumentName:name,type file

Where name is the name in the GATK tool (like "eval" in VariantEval), type is the type of the file, such as VCF or dbSNP, and file is the path to the file containing the ROD data.

The GATK supports several common file formats for reading ROD data:

  • VCF : VCF type, the recommended format for representing variant loci and genotype calls. The GATK will only process valid VCF files; VCFTools provides the official VCF validator. See [here] for a useful poster detailing the VCF specification.
  • UCSC formated dbSNP : dbSNP type, UCSC dbSNP database output
  • BED : BED type, a general purpose format for representing genomic interval data, useful for masks and other interval outputs. Please note that the bed format is 0-based while most other formats are 1-based.

Note that we no longer support the PED format. See here for converting .ped files to VCF.

Post edited by Geraldine_VdAuwera on

Geraldine Van der Auwera, PhD

Comments

Sign In or Register to comment.